Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 9501875
End position: 9501898
Length: 24

DNA sequence
>NC_021658, from 9501875 to 9501898 (24 bp); Sorangium cellulosum So0157-2 CGCCGGCGCCGCCACCGGCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9501501-9502262	Sequence	SCE1572_33360 - hypothetical protein (Protein is coded in complementary strand; from 9502262 to 9501501)