Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 9480605
End position: 9480628
Length: 24

DNA sequence
>NC_021658, from 9480605 to 9480628 (24 bp); Sorangium cellulosum So0157-2 GGCGCCAGCGCCGCCGCCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9479595-9480668	Sequence	SCE1572_33265 - hypothetical protein (Protein is coded in complementary strand; from 9480668 to 9479595)