Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 9416439
End position: 9416468
Length: 30

DNA sequence
>NC_021658, from 9416439 to 9416468 (30 bp); Sorangium cellulosum So0157-2 CCGCGAGCGCGAACGCGACGGCGACCGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9416114-9417511	Sequence	SCE1572_33055 - ATPase AAA (Protein is coded in complementary strand; from 9417511 to 9416114)