Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 9396446
End position: 9396472
Length: 27

DNA sequence
>NC_021658, from 9396446 to 9396472 (27 bp); Sorangium cellulosum So0157-2 GGCGAGCCGGGCGCGCCGGGCGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9395568-9397391	Sequence	SCE1572_33000 - hypothetical protein (Protein is coded in complementary strand; from 9397391 to 9395568)