Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 9350679
End position: 9350732
Length: 54

DNA sequence
>NC_021658, from 9350679 to 9350732 (54 bp); Sorangium cellulosum So0157-2 GCACCGGTACCACGGGCACGACCGGCACCACGGGCACGACCGGCACCACGGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9350570-9350959	Sequence	SCE1572_32840 - hypothetical protein (Protein is coded in complementary strand; from 9350959 to 9350570)