Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 9339182
End position: 9339205
Length: 24

DNA sequence
>NC_021658, from 9339182 to 9339205 (24 bp); Sorangium cellulosum So0157-2 GCGTCGGCGCCGGCGCCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9339158-9339976	Sequence	SCE1572_32785 - hypothetical protein (Protein is coded in complementary strand; from 9339976 to 9339158)