Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 9283712
End position: 9283735
Length: 24

DNA sequence
>NC_021658, from 9283712 to 9283735 (24 bp); Sorangium cellulosum So0157-2 GGCCGGAGCCGGAGCCGGCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9282771-9283814	Sequence	SCE1572_32630 - hypothetical protein (Protein is coded in complementary strand; from 9283814 to 9282771)