Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 9256088
End position: 9256132
Length: 45

DNA sequence
>NC_021658, from 9256088 to 9256132 (45 bp); Sorangium cellulosum So0157-2 CGGCCTCGAGCACGTCGGCCTCGAGCACGCCGGCCGCGAGCACGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9256003-9257334	Sequence	SCE1572_32550 - hypothetical protein (Protein is coded in complementary strand; from 9257334 to 9256003)