Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8951849
End position: 8951888
Length: 40

DNA sequence
>NC_021658, from 8951849 to 8951888 (40 bp); Sorangium cellulosum So0157-2 AGCGCATCAGGGCATCAGCGCATCAGCGCATCAGGGCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 8951880-8953919	Sequence	SCE1572_31500 - hypothetical protein (Protein is coded in complementary strand; from 8953919 to 8951880)