Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8924236
End position: 8924280
Length: 45

DNA sequence
>NC_021658, from 8924236 to 8924280 (45 bp); Sorangium cellulosum So0157-2 GCGCGGCCCGCTCGCGCTCGGCCCGCTCCCGCTCGGCGAGCTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8923833-8928866	Sequence	SCE1572_31395 - hypothetical protein (Protein is coded in complementary strand; from 8928866 to 8923833)