Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8818992
End position: 8819036
Length: 45

DNA sequence
>NC_021658, from 8818992 to 8819036 (45 bp); Sorangium cellulosum So0157-2 CGCGCTCGGCGGCGCGGCGCTCGGCGGCGCGGCGCTCGGCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8818918-8819712	Sequence	SCE1572_31050 - hypothetical protein (Protein is coded in complementary strand; from 8819712 to 8818918)