Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8777722
End position: 8777746
Length: 25

DNA sequence
>NC_021658, from 8777722 to 8777746 (25 bp); Sorangium cellulosum So0157-2 GCGGCGCCGCGCTGCGGGGCGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8777514-8778932	Sequence	SCE1572_30925 - hypothetical protein (Protein is coded in complementary strand; from 8778932 to 8777514)