Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8766002
End position: 8766028
Length: 27

DNA sequence
>NC_021658, from 8766002 to 8766028 (27 bp); Sorangium cellulosum So0157-2 GGCGCGACGGGCGCGCCGGGCGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8765573-8766730	Sequence	SCE1572_30865 - hypothetical protein (Protein is coded in complementary strand; from 8766730 to 8765573)