Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8763048
End position: 8763071
Length: 24

DNA sequence
>NC_021658, from 8763048 to 8763071 (24 bp); Sorangium cellulosum So0157-2 CGAGCGAGAGCGCGAGCGCGAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8760932-8763085	Sequence	SCE1572_30850 - hypothetical protein (Protein is coded in complementary strand; from 8763085 to 8760932)