Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8753653
End position: 8753697
Length: 45

DNA sequence
>NC_021658, from 8753653 to 8753697 (45 bp); Sorangium cellulosum So0157-2 GCGGCGGCGGTGGTGGAGGCGGCGGCGGAGGCGGCGGCGCTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8753358-8754131	Sequence	SCE1572_30815 - hypothetical protein (Protein is coded in complementary strand; from 8754131 to 8753358)