Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8752323
End position: 8752346
Length: 24

DNA sequence
>NC_021658, from 8752323 to 8752346 (24 bp); Sorangium cellulosum So0157-2 CCCGGCGCTCCGGCGCCGCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8752181-8752627	Sequence	SCE1572_30805 - biopolymer transporter ExbD (Protein is coded in complementary strand; from 8752627 to 8752181)