Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8711028
End position: 8711075
Length: 48

DNA sequence
>NC_021658, from 8711028 to 8711075 (48 bp); Sorangium cellulosum So0157-2 GCGAGGGCGAGGGCGAGGGCGAGGGCGAGGGCGAGGGCGAGGGCGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8710785-8711159	Sequence	SCE1572_30670 - hypothetical protein (Protein is coded in complementary strand; from 8711159 to 8710785)