Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8710579
End position: 8710602
Length: 24

DNA sequence
>NC_021658, from 8710579 to 8710602 (24 bp); Sorangium cellulosum So0157-2 CGCGGCCGCGGTCGTGGCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8709323-8710726	Sequence	SCE1572_30665 - ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 8710726 to 8709323)