Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8698279
End position: 8698308
Length: 30

DNA sequence
>NC_021658, from 8698279 to 8698308 (30 bp); Sorangium cellulosum So0157-2 CCGCCGACGCCGCCTCCGCCGCTGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8696443-8698362	Sequence	SCE1572_30605 - hypothetical protein (Protein is coded in complementary strand; from 8698362 to 8696443)