Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8614654
End position: 8614683
Length: 30

DNA sequence
>NC_021658, from 8614654 to 8614683 (30 bp); Sorangium cellulosum So0157-2 GCGGCGGCGGCGACGGCGGCGCCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8613678-8615360	Sequence	SCE1572_30320 - hypothetical protein (Protein is coded in complementary strand; from 8615360 to 8613678)