Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8602594
End position: 8602617
Length: 24

DNA sequence
>NC_021658, from 8602594 to 8602617 (24 bp); Sorangium cellulosum So0157-2 CCGCGTCCTCGTCCTCGTCCCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8602473-8603462	Sequence	SCE1572_30270 - hypothetical protein (Protein is coded in complementary strand; from 8603462 to 8602473)