Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8601664
End position: 8601717
Length: 54

DNA sequence
>NC_021658, from 8601664 to 8601717 (54 bp); Sorangium cellulosum So0157-2 GCGCCCCGCGCGGCGTGGGCGCCCCGCGCGGCGTCGGCGCCCCGCGCGGCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8600938-8601786	Sequence	SCE1572_30260 - short-chain dehydrogenase (Protein is coded in complementary strand; from 8601786 to 8600938)