Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8553890
End position: 8553913
Length: 24

DNA sequence
>NC_021658, from 8553890 to 8553913 (24 bp); Sorangium cellulosum So0157-2 GCGCCCGCGCCTCCGCCCGTGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8552942-8554138	Sequence	SCE1572_30075 - hypothetical protein (Protein is coded in complementary strand; from 8554138 to 8552942)