Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8539380
End position: 8539409
Length: 30

DNA sequence
>NC_021658, from 8539380 to 8539409 (30 bp); Sorangium cellulosum So0157-2 GCGGCGCGCCGCTTCGCGCCGAGCCGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8538492-8539763	Sequence	SCE1572_30020 - hypothetical protein (Protein is coded in complementary strand; from 8539763 to 8538492)