Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8508348
End position: 8508371
Length: 24

DNA sequence
>NC_021658, from 8508348 to 8508371 (24 bp); Sorangium cellulosum So0157-2 TCGCCCTCGCCCGCGCCCTCGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8507223-8508530	Sequence	SCE1572_29960 - hypothetical protein (Protein is coded in complementary strand; from 8508530 to 8507223)