Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 848870
End position: 848894
Length: 25

DNA sequence
>NC_021658, from 848870 to 848894 (25 bp); Sorangium cellulosum So0157-2 CGCCGCGCAGTGCCGCTCCGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 847554-851402	Sequence	SCE1572_03190 - hypothetical protein (Protein is coded in complementary strand; from 851402 to 847554)