Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8476640
End position: 8476675
Length: 36

DNA sequence
>NC_021658, from 8476640 to 8476675 (36 bp); Sorangium cellulosum So0157-2 CACGTTCGCCACGTTCGCCACGTTCGCCACGTTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8476624-8477724	Sequence	SCE1572_29820 - hypothetical protein (Protein is coded in complementary strand; from 8477724 to 8476624)