Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8387386
End position: 8387430
Length: 45

DNA sequence
>NC_021658, from 8387386 to 8387430 (45 bp); Sorangium cellulosum So0157-2 CACGGCCACCATCACCACGGCCATCATCACCACGGCCACCATCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 8386919-8387428	Sequence	SCE1572_29510 - hypothetical protein (Protein is coded in complementary strand; from 8387428 to 8386919)