Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8377729
End position: 8377782
Length: 54

DNA sequence
>NC_021658, from 8377729 to 8377782 (54 bp); Sorangium cellulosum So0157-2 CGGCGGCACGGGCGGCGCAGGTGGCATGGGCGGCGCTGGCGGCACGGGCGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 8377397-8377729	Sequence	SCE1572_29460 - hypothetical protein
ORF... 8377755-8379002	Sequence	SCE1572_29465 - hypothetical protein