Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 837710
End position: 837733
Length: 24

DNA sequence
>NC_021658, from 837710 to 837733 (24 bp); Sorangium cellulosum So0157-2 GAGCGCGAGCACGAACGCGAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 836289-837869	Sequence	SCE1572_03150 - hypothetical protein (Protein is coded in complementary strand; from 837869 to 836289)