Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8305967
End position: 8306029
Length: 63

DNA sequence
>NC_021658, from 8305967 to 8306029 (63 bp); Sorangium cellulosum So0157-2 CCCCGCCTCCGGCGCCGCTGGCCCGCCCGCCGGCGCCGCTGGCCCGCCCGCCGGCGCCGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8305197-8306132	Sequence	SCE1572_29180 - hypothetical protein (Protein is coded in complementary strand; from 8306132 to 8305197)