Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8253909
End position: 8253962
Length: 54

DNA sequence
>NC_021658, from 8253909 to 8253962 (54 bp); Sorangium cellulosum So0157-2 CCCGAACCCCGGCGGCGCCCCGAACCCCGGCGGTGCCCCGAACCCCGGCGGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8253886-8254899	Sequence	SCE1572_29005 - hypothetical protein (Protein is coded in complementary strand; from 8254899 to 8253886)