Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 823659
End position: 823688
Length: 30

DNA sequence
>NC_021658, from 823659 to 823688 (30 bp); Sorangium cellulosum So0157-2 CCGCGGCGAGCCGCCGCGCGCCGCCGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 823274-825385	Sequence	SCE1572_03100 - hypothetical protein (Protein is coded in complementary strand; from 825385 to 823274)