Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8234098
End position: 8234157
Length: 60

DNA sequence
>NC_021658, from 8234098 to 8234157 (60 bp); Sorangium cellulosum So0157-2 GGGAGAGGCCAGGGGAGAGGCCAGGGGAGAGGCCAGGGGAGAGGCCAGGGGAGAGGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8234006-8234998	Sequence	SCE1572_28895 - hypothetical protein (Protein is coded in complementary strand; from 8234998 to 8234006)