Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8044987
End position: 8045022
Length: 36

DNA sequence
>NC_021658, from 8044987 to 8045022 (36 bp); Sorangium cellulosum So0157-2 TCCCGCTGCTGCTGCTGCTGCTGCTCGTGCTGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8044680-8046086	Sequence	SCE1572_28110 - hypothetical protein (Protein is coded in complementary strand; from 8046086 to 8044680)