Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 8001127
End position: 8001156
Length: 30

DNA sequence
>NC_021658, from 8001127 to 8001156 (30 bp); Sorangium cellulosum So0157-2 CTGATTACCCCTGATTACCCCTGATTACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 8001152-8001514	Sequence	SCE1572_27945 - hypothetical protein (Protein is coded in complementary strand; from 8001514 to 8001152)