Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 796818
End position: 796841
Length: 24

DNA sequence
>NC_021658, from 796818 to 796841 (24 bp); Sorangium cellulosum So0157-2 TCGTCCTCGTCCTCGTCCTCGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 796641-798131	Sequence	SCE1572_02975 - hypothetical protein (Protein is coded in complementary strand; from 798131 to 796641)