Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 7958110
End position: 7958134
Length: 25

DNA sequence
>NC_021658, from 7958110 to 7958134 (25 bp); Sorangium cellulosum So0157-2 CCCGGCCCGGTCCGGCGCGGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7957730-7959163	Sequence	SCE1572_27800 - sigma-54 dependent transcriptional regulator (Protein is coded in complementary strand; from 7959163 to 7957730)