Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 791273
End position: 791335
Length: 63

DNA sequence
>NC_021658, from 791273 to 791335 (63 bp); Sorangium cellulosum So0157-2 ACCGGCGGCGGGCGGCGTGGCGCCAGCGGCGGGCGGCGTGGCGCCGGCGGCGGGCGGCGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 790263-791534	Sequence	SCE1572_02945 - hypothetical protein (Protein is coded in complementary strand; from 791534 to 790263)