Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 7761421
End position: 7761483
Length: 63

DNA sequence
>NC_021658, from 7761421 to 7761483 (63 bp); Sorangium cellulosum So0157-2 GGCGCGCCCTCCGCGCCGGGAGGCGCGCCCTCCGCGCCGGGAGGCGCGCCGACCGCGCCGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7760887-7761729	Sequence	SCE1572_27115 - tRNA (guanine-N1)-methyltransferase (Protein is coded in complementary strand; from 7761729 to 7760887)