Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 7719546
End position: 7719575
Length: 30

DNA sequence
>NC_021658, from 7719546 to 7719575 (30 bp); Sorangium cellulosum So0157-2 TTACTCGCTCTTACTCGCTCTTACTCGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 7719557-7720690	Sequence	SCE1572_26930 - hypothetical protein (Protein is coded in complementary strand; from 7720690 to 7719557)