Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 7651843
End position: 7651877
Length: 35

DNA sequence
>NC_021658, from 7651843 to 7651877 (35 bp); Sorangium cellulosum So0157-2 CCCCTCGCCCCTCGCCCCTCGCCCCTCGCCCCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 7650672-7651844	Sequence	SCE1572_26695 - hypothetical protein (Protein is coded in complementary strand; from 7651844 to 7650672)