Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 7578575
End position: 7578598
Length: 24

DNA sequence
>NC_021658, from 7578575 to 7578598 (24 bp); Sorangium cellulosum So0157-2 CCGCCGCCGCCCGCGCCGCCGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7576979-7578697	Sequence	SCE1572_26440 - hypothetical protein (Protein is coded in complementary strand; from 7578697 to 7576979)