Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 7503392
End position: 7503415
Length: 24

DNA sequence
>NC_021658, from 7503392 to 7503415 (24 bp); Sorangium cellulosum So0157-2 CTCCGCCTCGGCCTCCGCCTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7503231-7503467	Sequence	SCE1572_26180 - hypothetical protein (Protein is coded in complementary strand; from 7503467 to 7503231)