Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 7382202
End position: 7382261
Length: 60

DNA sequence
>NC_021658, from 7382202 to 7382261 (60 bp); Sorangium cellulosum So0157-2 CACGCGCGCCGCCCGGTCGACAGGCGCGCCGCCCGGTCGACAGACGCGCCGCGCGGTGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7381989-7382276	Sequence	SCE1572_25725 - hypothetical protein (Protein is coded in complementary strand; from 7382276 to 7381989)