Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 7348876
End position: 7348899
Length: 24

DNA sequence
>NC_021658, from 7348876 to 7348899 (24 bp); Sorangium cellulosum So0157-2 CGTCGTCGACGTCGGCGTCGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7348551-7351103	Sequence	SCE1572_25605 - hypothetical protein (Protein is coded in complementary strand; from 7351103 to 7348551)