Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 7344525
End position: 7344578
Length: 54

DNA sequence
>NC_021658, from 7344525 to 7344578 (54 bp); Sorangium cellulosum So0157-2 CGCTGCCGGCGCCGCGCTCGCTGCCGGCGCCGCGCTCGCTGCCGGCGCCGCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7343722-7344798	Sequence	SCE1572_25590 - hypothetical protein (Protein is coded in complementary strand; from 7344798 to 7343722)