Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 7314687
End position: 7314710
Length: 24

DNA sequence
>NC_021658, from 7314687 to 7314710 (24 bp); Sorangium cellulosum So0157-2 GGCTCAGCGGCTCACCGGCTCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 7314707-7316263	Sequence	SCE1572_25480 - sulfate transporter (Protein is coded in complementary strand; from 7316263 to 7314707)