Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 7296795
End position: 7296839
Length: 45

DNA sequence
>NC_021658, from 7296795 to 7296839 (45 bp); Sorangium cellulosum So0157-2 CGCGCGAGCGCGCTGTGGGCGAACGCGCTGTGGGCGAGCGCGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7294545-7300280	Sequence	SCE1572_25420 - hypothetical protein (Protein is coded in complementary strand; from 7300280 to 7294545)