Sequence retrieval

Genome: Sorangium cellulosum So0157-2
Start position: 7274924
End position: 7274968
Length: 45

DNA sequence
>NC_021658, from 7274924 to 7274968 (45 bp); Sorangium cellulosum So0157-2 TCGATGATCTTCTTGACCGTGATCTTCTTGTCGATGTTCTTCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7274084-7275910	Sequence	SCE1572_25340 - hypothetical protein (Protein is coded in complementary strand; from 7275910 to 7274084)